bnicole31003 bnicole31003

Today at 8:04 PM
Physics

Answered

the table below shows the number of the sub-atomic particles in an atom of nitrgen. what is the amu of a nitrogen atom?

the table below shows the number of the sub-atomic particles in an atom of nitrgen. what is the amu of a nitrogen atom? class=

Answer :

MiNk2019314 MiNk2019314

Today at 8:08 PM

The atomic mass of an atom is the sum of its protons and neutrons. There are 7 of each, so the atomic mass of nitrogen is 7+7, or 14 amu.

Answer Link

Other Questions

the function f is continuous and differentiable on the closed interval [0,4]. the table above gives selected values of f on this interval. which of the followin

in march, an investment adviser wishes to increase its annual management fee from 1% of assets annually to 1.25% of assets annually, starting the following july

harry readily adopted his parent's political beliefs without question. happy and secure, he enjoys participating in political events with his parents. his ident

Broker A has a small brokerage, with only 1 sales agent. The sales agent has procured an exclusive right to sell listing agreement with a seller. The agreement

the function f is continuous and differentiable on the closed interval [0,4]. the table above gives selected values of f on this interval. which of the followin

As you all know COVID-19 is a menace to the world right now. This activity is regarding the same. Collect the data of the number of patients that are being admi

Which expression represents the difference quotient of the f

I've made a monolith of code that works, but I'm having trou

Many people use mobile apps and online software to manage and create personalized budgets. Suppose your task is to develop an online tool for personal budgeting

Why did ashoka put up his edicts in public places?

Firm A has a stock price of $35, and 60% of the value of the stock is in the form of PVGO. Firm B also has a stock price of $35, but only 20% of the value of st

gendy co. expects to receive eur 5 million tomorrow as a result of selling goods to a firm in france. gendy estimates the standard deviation of daily percentage

page 254 8.1. explain the reasons for the fragmentation of political power throughout most of europe during this period. after reading the textbook, watch this

A random sample of 65 high school seniors was selected from all high school seniors at a certain high school. The following scatterplot shows the height, in cen

ta-nehisi was walking back to his dorm after studying until midnight. when a car slowed down and began to trail him, he began to feel fear. he broke into a swea

During 2018, Hardy Merchandising Company purchased $15,000 of inventory on account. Hardy sold inventory on account that cost $11,300 for $16,900. Cash payments

select all that apply select all the characteristics of most nineteenth-century nationalistic music that made the trend popular. multiple select question. it wa

Sales agents Hattie and Bob work for broker Phil. Hattie procures a listing agreement from a seller and Bob procures a buyer representation agreement with a buy

select all the descriptions that apply to expressionist artists, writers, and composers. multiple select question. they explored their inner feelings rather tha

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul