figueroamelany316 figueroamelany316

Today at 10:55 PM
Biology

Answered

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Answer :

raduoprea160 raduoprea160

Today at 11:00 PM

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Answer Link

Other Questions

The function f has the property that, for all x, 5f(x) = f(5x). If f(20) = 40, what is the value of f(4)?

**HELP!!!!** ILL GIVE BRAINLIEST

Nvm I got the answer

Nvm I got the answer

Nvm I got the answer

what is the meaning of Fabulous?

A horse eats 16 kg of corn in 12 days ? How much does he eat in 9 days? (10 Point)

How does the mouth nose throat and lungs fight against pathogens

Character sketch of Swaminathan in the story Father's help by R K Narayan

Explain me Dilution of concentratedAcid class 10th i making notes.

Sum of x and it’s square is equal to y times z

A space shuttle does one full orbit every 90 minutes. The radius of Earth including the shuttle's orbit is 6.371x10^6m. What is the speed of the shuttle in mi/h

The environment can greatly influence the course of human events.

Solve the equation for k. 10k-5z = 30

Build a bear for your roller coaster. Measure the length of a beam in centimeters. What would be the length of 100 beams in centimeters if you were to put them

In five to ten sentences, describe the procedure for sending an e-mail message.

How are glossaries different from dictionaries?(1 point) aGlossaries only contain the pronunciations of words. Glossaries only contain the pronunciations of wor

117 151/200 is equivalent to

Find the space inside a rectangle with a width of 12 and a length of 16.

When b > 1, as x grows in the negative direction, y . When 0 < b < 1, as x grows in the negative direction, y .