t93smbtxrz t93smbtxrz

Today at 10:20 AM
History

Answered

The point K (6, -3) Is rotated 180° clockwise around the origin.
What are the coordinates of the resulting point, K' ?

Answer :

leahtgarland leahtgarland

Today at 10:25 AM

(-6, 3)

(x, -y) = (-x, y)

Hope this helps!

Answer Link

Other Questions

Let f(x)=−1/2(x+2)^2+5 . What is the average rate of change for the quadratic function from x=−3 to x = 1? Enter your answer in the box. Show your work

They looked like little flags floating everywhere. "" Here the narrator implies

What made a glass paper or a thin plastic sheet stick on objects?

Write an email to the principal of your college requesting him to call teachers meeting before exams

A 1210-kg car travels 1. 20 km up an incline at constant velocity. The incline is 15° measured with respect to the horizontal. The change in the car's potential

What is the rule for finding an inverse mapping

F. Answer in detail. 1. Name the oceans of the world and briefly describe each.2. What are seas ? Differentiate between different kinds of seas.3. Explain the i

❤️ meaning explain me what is ❤️

We know that constipation can be very dangerous, and that ma

in the figure o is the centre of the circle

You are given a sample (2.000 g) of an unknown Group 2 (alkali earth) carbonate to analyze. You react it with excess HCl(aq) (40.00 mL, 1.000 mol/L). The mixtur

If 20V battery in the left side and 10V battery to the right side (both cases the positive voltage is on the upside) is applied to a resistive circuit of 10Ω. W

Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A:

Find the momentum of a helium nucleus having a mass of 6.68 times 10^{-27} kg that is moving at 0.200

evaluate the limit. (use symbolic notation and fractions where needed.) lim x→1 (4x-5)^3

find the second taylor polynomial t2(x) for the function f(x)=ln(x) based at b=1. t2(x) =

find limx→3− f(x) where f(x) = √9−x^2 if 0≤x<3, if 3≤x< 7, if x=7

this is the price at which the lessee (consumer), can purchase the car after the lease has expires.

Gas phase reaction: 4HCl(g) + O2(g) --> 2Cl2 (g) + 2H2O (g) what volume of chlorine can be prepared at STP from the reaction of 600mL of gaseous HCl with excess

Which cause BEST explains the itchiness associated with mosquito bites? A. an adaptive immune system response to molecules found in mosquito saliva B. an innate