booneolon1
booneolon1
Today at 3:18 PM
Mathematics
Answered
1cm=10ft than what is 2.1cm
Answer :
Аноним
Аноним
Today at 3:23 PM
The answer is 1=10
1*2.1=2.1
10*2.1=21
2.1 cm = 21 ft
Answer Link
VIEW ALL ANSWERS ( 94+ )
Other Questions
What is the area of this triangle?NO SPAM OR I WILL REPORT YOU AND BAN YOU IMMEDIATELY
Pleaseseee help Two one-step equations Two equations that contains fractions One equation with distributive property One equation with decimals One real-world p
Pleaseseee help Two one-step equations Two equations that contains fractions One equation with distributive property One equation with decimals One real-world p
What made a glass paper or a thin plastic sheet stick on objects?
Write an email to the principal of your college requesting him to call teachers meeting before exams
history of trigonometry in brief
Which of the following is/are correct?I. There are only 5 rational numbers between 17and 67II. Every decimal number can either be rational or irrational. (A) On
give any four example of home based self employment opportunities area of home science
If there are two pathogenic viruses, one with DNA and the other with RNA, which would mutate faster
Write. Conclusion for my english grammer project
“In ancient Rome, at the time of Emperor Tiberius, there lived a good man who had two sons. One was in the military, and had been sent to the most distant regio
What is the latitude and longitude of Pass Christian,MS on a map?
True/False. spanking a newborn is required to initiate the infant's first breaths.
Predict the rate law for the reaction NO(g) + Br2(g) ? NOBr2(g) under each of the following conditions: A. The rate doubles when [NO] is doubled and [Br2] remai
Given a script called script1 containing the following line: echo $2 then the script is executed as script1 red blue green What is the value displayed ? a.green
Your bank offers an annual nominal interest rate of 5% compounded 12 times per year. What is the effective interest rate on the account? 0.0557 0.05 0.621 0.05
You are given a sample (2.000 g) of an unknown Group 2 (alkali earth) carbonate to analyze. You react it with excess HCl(aq) (40.00 mL, 1.000 mol/L). The mixtur
If 20V battery in the left side and 10V battery to the right side (both cases the positive voltage is on the upside) is applied to a resistive circuit of 10Ω. W
Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A:
Find the momentum of a helium nucleus having a mass of 6.68 times 10^{-27} kg that is moving at 0.200
