Answered

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule.
AACCTGGCCATGGACCTTTATATAAACTAGGAT
The researcher wants to revise the model to show the transcription of DNA to form mRNA.

7. A student claims that the mRNA will include the following base sequence. UUGGUCCGGUACCUGGAAAUAUAUUUGAUCCUA
The researcher argues the student’s claim is faulty. The mRNA likely will not include the sequence that the student proposes.
Which features of transcription support the researcher’s argument?
a. Transcription produces a molecule of mRNA with the same bases as DNA, and in the same order.
b. Many base sequences are cut out of the DNA molecule before transcription occurs.
c. Base sequence in a DNA molecule may be transcribed into introns of pre- mRNA.
d. After translation, introns and exons are added to pre-mRNA to form completed mRNA.

Answer :

Other Questions