dogerboy1912 dogerboy1912

Today at 10:53 PM
Mathematics

Answered

Use the Basic Derivative Rules to differentiate each of the following functions.
a. g(x) = 2 / x⁶ + x⁶/2

Answer :

Other Questions

John has five times as much money as Stuart. John has $83.40. How much money does Stuart have?

Write a AEC on the first amendment argument essay on why it’s important to individuals ,civil virtues ,and for human right with 3 piece of evidence

The property tax that raises the most revenue for local governments is the tax on a. automobiles. c. real estate. b. intangible personal property. d. tangible p

Genration of used magnetic drums for memory

El triángulo obtusangulo todas las alturas son inferiores al

A powered winch is used to pull a sailboat to shore. The win

In a test (+4) marks are given for every correct answer and (-2) marks are given for every incorrect answer. Amit answered all the questions and scored 50 marks

-13 एक उत्तल लेंस के गोलीय पृष्ठों की वक्रता त्रिज्याएँ क्रमश: 15 सेमी. और 10 सेमी. हैं। यदि लेंस काअपवर्तनांक 1.5 हो तो लेंस की फोकस दूरी ज्ञात कीजिए।

Arrange the following numbers in ascending order (From the least to the greatest). (1) +8,+4,0,+2,+3 = (2) -1,-11,-5,-0,-12

Method printAll() and its recursive method to display the details of disease in descending order according to death percentage.

Transribe and translate the following dna strand GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Which of the following is a type of iterative method of solving non linear equations *?

Which operation must be done on both sides of the given equation in order to solve them 1 8x =24?

In which ratio line segment joining 1/2 and (- 2 1 cuts the line 3x 4y 7?

Which of the following methods is the best way to compare the lengths of two line segments? A Comparison by observation B Comparison by tracing, using a tracing

Which of the following is not included in the Preamble of the Indian Constitution? A.Justice B.Freedom C.Equality D.Liberty

Which of the following is the equivalent of 2½ in decimal?

Which of the following quotes best reflects the principle of social contract in the Declaration of Independence 2.00 pretest? a. "He has called together legisla