hannahgrace452 hannahgrace452

Today at 2:58 AM
Chemistry

Answered

Classify these compounds as strong electrolytes, weak electrolytes, or nonelectrolytes k3po4

Answer :

Kalahira Kalahira

Today at 3:04 AM

Answer: (Ka = 6.8*10^-4). K3PO4 is the salt of a weak acid and a strong base. It ionizes mostly, (Kb = 0.025) and is a mild electrolyte.

Answer Link

Other Questions

Base Sequence of Complementary DNA Strands: One strand of a double-helical DNA has the sequence (5’)GCGCAATATTTCTCAAAATATTGCGC(3’). a) Write the base sequence o

Assume both portfolios A and B are well diversified, that E(rA) = 13.4% and E(rB) = 15.0%. If the economy has only one factor, and βA = 1 while βB = 1.2, what m

If the per-worker production function is y = Ak, where A is a positive constant, in the steady state, a: lower saving rate leads to a higher growth rate. higher

Suppose that the central bank has increased the money supply such that there is an additional $ 231115 in excess reserves. If the reserve ratio is 15 percent, w

The difference between a merger and an acquisition is: Select one: a. That a merger involves one company purchasing the assets of another company with cash, whe

Where are the following located ? State their mainfunctions.(a) Yellow spot(b) Lacrimal gland(c) Organ of Corti(d) Semicircular canal(e) Oval window(f) Utriculu

describe the changes that o ccured in the composition of the company's army

হিমবাহ কাক বোলে assmese legeo

29 NaOH in 50 ml solution.help plz

what is the use of KOH in Mohls half leaf experiment

A Luz (1) tomar café en el desayuno, (2) el jugo de naranja. En el almuerzo (3) comer arroz y carne. Pero hoy (4) comer mucho y (5) tomar verduras. Para cenar,

Which of the following has no effect on the monthly payment?

Consider the following balanced equation for the following reaction: 15O2(g) + 2C6H5COOH(aq) → 14CO2(g) + 6H2O(l) Determine the amount of CO2(g) formed in the r

Union employees vote for a representative to negotiate on behalf of all workers. This representative negotiates 3% increase in wages, but requires workers to co

What best summarizes the peppered moths in England after the Industrial Revolution?

Which information is a epposite isometry?

Down ballot refers to: A. elections that occurred prior to the help america vote act B. an election in which the national chief executive is elected. C. an elec

The regular selling price of an item is $169. For a special year-end sale the price is at a markdown of 20%. Find the discount sale price.

hunters are allowed to use bows rifles and what other form of weapon for hunting

Why was the colonization of Africa, Asia, and the Americas shared by Britain, France, and Spain?