ElizabethMartin5621 ElizabethMartin5621

Today at 2:59 AM
Social Studies

Answered

Cessation of menstruation is most likely associated with

Answer :

Today at 3:04 AM

The reasons for cessation of menstruation can be multiples: pregnancy, stress, weight oscillations (unhelthy weight gain or weight loss), eating disorders (bulimia and anorexia), polycystic ovaries, thyroid disorders, using some type of medicines and drugs (chemotherapy for example). All of this reasons are only reasons for temporarily cessation of menstruation. Permanent cessation of menstruation is the result of menopause.

Answer Link

Other Questions

Three force vectors are added together. One has a magnitude of 9 N, the second one a magnitude of 18 N, and the third a magnitude of 15 N. What can we conclude

An electrode has a potential of 1.201 V with respect to a saturated silver-silver chloride electrode. What would the electrodes potential be relative to a satur

Base Sequence of Complementary DNA Strands: One strand of a double-helical DNA has the sequence (5’)GCGCAATATTTCTCAAAATATTGCGC(3’). a) Write the base sequence o

The difference between a merger and an acquisition is: Select one: a. That a merger involves one company purchasing the assets of another company with cash, whe

Suppose that the central bank has increased the money supply such that there is an additional $ 231115 in excess reserves. If the reserve ratio is 15 percent, w

Where are the following located ? State their mainfunctions.(a) Yellow spot(b) Lacrimal gland(c) Organ of Corti(d) Semicircular canal(e) Oval window(f) Utriculu

describe the changes that o ccured in the composition of the company's army

হিমবাহ কাক বোলে assmese legeo

29 NaOH in 50 ml solution.help plz

what is the use of KOH in Mohls half leaf experiment

Jennifer Company has two products: A and B. The company uses activity-based costing. The estimated total cost and expected activity for each of the company's th

Why might credentialism be an obstacle to growth? Instructions: In order to receive full credit, you must make a selection for each option. For correct answer(s

An airplane is flying at 150 ft/s at an altitude of 2000 ft in a direction that will take it directly over an observer at ground level. Find the rate of change

The following information relates to Bramble Corp. for the year 2022. Retained earnings, January 1, 2022 $47,040 Advertising expense $1,760 Dividends during 202

A balloon is 200 ft. off the ground and rising vertically at the constant rate of 15 ft/sec. An automobile passes beneath it traveling along a straight road at

A blood bank asserts that a person with type O blood and a negative Rh factor (Rh?) can donate blood to any person with any blood type. Their data show that 43%

A 41-year-old male client has presented to the emergency department with an acute onset of increased respiratory rate and difficulty breathing. STAT chest X-ray

Which of the following statements best describes the government of Somalia? A. a democracy with a stable parliamentary government B. an anarchy where rival warl

Upon discovering fraudulent data in a client’s tax return that the client would not correct, a CPA withdraws from the engagement. How should the CPA respond if

Olmo, Inc., manufactures and sells two products: Product K0 and Product H9. The annual production and sales of Product of K0 is 600 units and of Product H9 is 6