a0268561 a0268561

Today at 2:58 AM
History

Answered

What was one of the ways the Crusades helped contribute to the end of medieval Europe?

Answer :

VivaciousLyla VivaciousLyla

Today at 3:04 AM

HeY yOu! HeRe'S tHe AnSwEr:

The Crusades contributed to increase the wealth of the Church and the power of Papacy. The Crusades helped to spread trade and knowledge throughout much of Europe.

I Really Hope This Helped You, Good Luck With Your Studies! =)

Answer Link

Other Questions

Base Sequence of Complementary DNA Strands: One strand of a double-helical DNA has the sequence (5’)GCGCAATATTTCTCAAAATATTGCGC(3’). a) Write the base sequence o

If the per-worker production function is y = Ak, where A is a positive constant, in the steady state, a: lower saving rate leads to a higher growth rate. higher

If the per-worker production function is y = Ak, where A is a positive constant, in the steady state, a: lower saving rate leads to a higher growth rate. higher

Three force vectors are added together. One has a magnitude of 9 N, the second one a magnitude of 18 N, and the third a magnitude of 15 N. What can we conclude

The difference between a merger and an acquisition is: Select one: a. That a merger involves one company purchasing the assets of another company with cash, whe

what is the diference between hill area and plane area

why do we need to save electricity answer me in a simple way

which books is best for mathematics in class 10 for board exam?

find the value of x and y

hey!!!!plzzzz help me help. and don't right nonsense answers

The Hypotenuse-Leg Theorem states that if the hypotenuse and leg of one right triangle is congruent to the hypotenuse and corresponding leg of another right tri

Which of the following is the goal of the peer review process?

Wendy stated that 3(2)+1 is equal to 3+1+3+1. Is she correct? Why or why not?

what was one cause of the war in 1812

When a solution of cesium chloride (CsCl) is subjected to high-speed centrifugation, a stable density gradient is formed. Meselson and Stahl found that when cel

OrdenarDrop down Activity Audio Textbook InstructionsEscucha la rutina diaria de Marta. Después ordena los verbos según lo que escuchaste. March 24 11:59 PM 2 a

Question 1 with 1 blankEsta semana llamarte varias veces por teléfono, pero estuve ocupadísima. Question 2 with 1 blankMi esposo y yo no brindar con los invitad

Members in a small group in class are assigned the task of making a film illustrating an important concept in their learning class. Some students in each group

Hydrogen gas (a potential future fuel) can be formed by the reaction of methane with water according to the following equation: CH4(g)+H2O(g)→CO(g)+3H2(g) In a

The department chair had allotted plenty of time for all department (and project) members to prepare sections of their five-year program review. Administration