heylol51 heylol51

Today at 3:35 AM
Mathematics

Answered

6) Use triangles to find the sum of the interior angle
measures of the polygon. (draw to show work)

Answer :

Other Questions

Most enslaved Africans lived on large plantations in the Southern colonies because What?

help please. thanks :))

There are pens, pencils and markers in a desk drawer. The ratio of pens to pencils is 2:3. The ratio of markers to pencils is 1:3. If there are 4 pens in the dr

Most enslaved Africans lived on large plantations in the Southern colonies because What?

There are pens, pencils and markers in a desk drawer. The ratio of pens to pencils is 2:3. The ratio of markers to pencils is 1:3. If there are 4 pens in the dr

Suresh was one worker who worked earnrstness.

Find the maximum number of 3 ohm resistors required to form a circuit of effective resistance 19 ohm?

Tori examined the pattern of exponents in the table. Powers of 6 Value 6 cubed 216 6 squared 36 6 Superscript 1 6 6 Superscript 0 1 6 Superscript negative 1 a 6

what are the components of brain stem and their function

Write 5 uses to drink milk

What is the area of rectangle ABCD?

21 III Choose the geologic formation that fits the description: rocks are stretched, moved vertically into blocks, and dropped; the lower blocks are called grab

Determine if the statement is true or false. The chain of custody document includes information about the location where a piece of evidence was found.A. TrueB.

English on edmentum Based on what you've read in the lesson and watched in the video, describe how the political upheaval during the revolutionary era influence

PLEASE HELP!!! Segments DE, EF, and DF are midsegments of AABC. Find the length of the indicated segment.

After reading the slave narratives, which logical conclusion can be made? A) None of these answers. B) Enslaved persons were all rebellious. C) There was a pers

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

How do you see your community's potential in engaging in the fitness industry?

Solute 3x+5=4x in step by step form please

4 ten and 17 hundredth in decimals UNSERIOUS ANSWERS REPORTED